Marco abierto de lectura



  En genética se llama marco abierto de lectura (siglas ORF del inglés Open reading frame) a cada una de las secuencias de ADN comprendida entre un codón de inicio (ATG) de la traducción y un codón de terminación, descontando las secuencias que corresponden a los intrones en caso de haberlas. Se encuentra acotado por los UTRs, o secuencias no traducidas.

Conocimientos adicionales recomendados

En una secuencia de ADN cualquiera hay, a priori, 6 posibles sentidos en los que pueden aparecer marcos abiertos de lectura; dado que cada codón toma 3 nucleótidos, existen 3 posibles lugares de inicio para tomar los nucleótidos de 3 en 3, si se tomara un cuarto nucleótido como lugar de inicio, haría coincidir el marco abierto de lectura con el mismo que si se toma el primer nucleótido. A lo que hay que sumar los otros 3 posibles marcos abiertos de lectura si el ADN es traducido tomando como molde la hebra complementaria, dando el sentido de lectura opuesto.

Estos marcos abiertos de lectura se denominan +1, +2, +3, -1, -2 y -3.

En un ejemplo con la secuencia 5' aactgcagtacgtaacgtca 3'

+3 5'   a act gca gta cgt aac gtc a 3'
+2 5'  aa ctg cag tac gta acg tca   3'
+1 5' aac tgc agt acg taa cgt ca    3'
-1 3' ttg acg tca tgc att gca gt    5'
-2 3'  tt gac gtc atg cat tgc agt   5'
-3 3'   t tga cgt cat gca ttg cag t 5'

Cada uno de los 6 posibles marcos abiertos de lectura dará lugar a una secuencia proteica absolutamente diferente.

En inglés el marco abierto de lectura se denomina ORF (open reading frame).

Véase también

 
Este articulo se basa en el articulo Marco_abierto_de_lectura publicado en la enciclopedia libre de Wikipedia. El contenido está disponible bajo los términos de la Licencia de GNU Free Documentation License. Véase también en Wikipedia para obtener una lista de autores.
Su navegador no está actualizado. Microsoft Internet Explorer 6.0 no es compatible con algunas de las funciones de Chemie.DE.